1.How to prepare a single cell suspension? How about the company's suspension preparation experience?

For cells that are already in suspension, magnetic bead-enriched cells, or flow-sorted cells, only washing and counting are required. However, when processing tissue samples, they must first be dissociated by mechanical or enzymatic methods. In order to achieve the best treatment effect, the experimental method needs to be optimized many times. At present, SeekGene's experimental team has completed more than 500 single-cell projects and has experiences in dissociation of more than 8,000 tissues. Based on this, SeekGene also implemented filing of various types of tissues and list matters for attentions. You can rest assured to send the samples to SeekGene. Dissociation belongs to the advanced level in the single-cell sequencing industry.

2. What are the precautions for tissue sampling?

Answer: The precautions for sampling are as follows: 1. Try to avoid getting necrotic, calcified, hardened, and fibrotic parts when sampling (especially diseased tissues); 2. If the operation involves cutting the tissues with an electrosurgical knife, remove the necrotic tissue due to contact with the electrosurgical knife; 3. Ensure that there is no freezing during the target tissue operation; 4. The tissue can be trimmed after sampling. Remove the non-target site as quickly as possible and put it in the tissue preservation solution as soon as possible, so as not to affect the final sequencing result. 5. Digestive system tissues need to be washed with PBS or saline several times. 6. Older animal specimens should be sent to the laboratory for dissociation as soon as possible. 7. Whether the experimental model will affect the cells. For example, after silica particles are injected into the lungs of mice, the density of silica is similar to that of cells, and it cannot be removed later. 8. Whether the drug treatment will affect the cells. For example, after tumor treatment, most of the fragments formed by tumor cell apoptosis are not easily distinguished from the cells, which affects the nucleation rate of cytoplasmic inspection.

3. What are the precautions when transporting samples?

Answer: The precautions for sample transportation are as follows: 1. Before sending all samples, the sample name, sampling time, and tissue type must be clearly marked on the tube walls. 2. All samples should be notified to our salespersons before and after sending out. Fill in the electronic version of the demand form and the courier number in time to facilitate the laboratory to receive samples and arrange experiments. 3. If it is an infectious sample, please be sure to inform our salespersons in advance. 4. Contact SeekGene salesperson in advance to obtain tissue storage solution (or bring your own storage solution: MACS Tissue Storage Solution, Miltenyi Biotec, item number 130-100-008). The standard is 1.5mL/sample. If the tissue is large, you can apply for the use of 5ml/sample preservation solution. Cut about 200mg of tissue (the size of a soybean grain). If there is a lot of organization, you can take 2-3 spares or apply for 5ml. 5. Wash the obtained tissue with PBS or saline to remove the blood in the tissue. 6. Put the washed tissue sample into a 1mL (or larger) preservation tube filled with tissue preservation solution. 7. Seal the preservation tube with parafilm and put it in a suitable foam box. And put 2~3 -20℃ frozen biological ice bags in the foam box, and seal the foam box. 8. Contact the courier company for mailing. Please contact the staff of the company in advance before mailing, so as not to deal with the samples after they arrive. The tissue samples must be delivered to the company within 48 hours.

4. How to determine the number and activity of the cell suspension?

Answer: You can stain with trypan blue and observe and count with a microscope. This is because the cell membranes of living cells are selectively permeable, which can block trypan blue and not be stained. The cell membrane of dead cells is more permeable, so it can be dyed blue by trypan blue. Specific steps are as follows: 1. Mix 20ul single cell suspension with 20ul trypan blue; 2. Take 20ul and add it to the cell counting plate with the modified cover glass; 3. Observe and count the number and color of cells under a microscope. Dead cells are light blue and dull, while living cells are not colored and have normal morphology and are shiny; 4. Count the total number of cells and the number of dead cells in the counting area in a field of view, and calculate the cell concentration, total amount and activity according to the formula. Multiple fields of view can be averaged. Automatic cell counters can be used to detect the number and activity of cells, such as the Countstar series. The principle is to use the Countstar Rigel S2 system, through the fluorescent dye AOPI that combines acridine orange and propidium iodide cell nuclear nucleic acid. AO can penetrate live and dead cells to stain the nucleus and emit green fluorescence, while PI can enter dead cells to stain the cell and emit red fluorescence. Therefore, AO/PI, as a nuclear dye, can accurately distinguish live cells from dead cells, and can eliminate the interference of impurities or non-specific cells, and perform accurate concentration and viability detection.

5. If some cells in the tissue have spontaneous color (or autofluorescence), can they also be tested for viability with an automatic cell counter?

Answer: If the tissue contains some spontaneously colored cells, such as some black cells in the choroid or melanoma tissue, there is no way to count the fluorescence with an automatic counter. In this case, the operator is required to observe the integrity of the cell membrane through a microscope to determine the size of cell activity.

6. Why can't the cell culture medium and buffer contain Ca 2+ and Mg 2+ ions?

Answer: Because Ca 2+ and Mg 2+ ions will affect the activity of reverse transcriptase, it will affect the subsequent cDNA generation, and ultimately increase the risk of library construction.

7. When preparing a single cell suspension by enzymatic hydrolysis, which enzyme should I choose to dissociate my tissues?

Answer: At present, when preparing single cell suspension, it is necessary to select a more applicable enzyme according to the tissue and cell type, and even a mixture of multiple enzymes can be used. The list shows the types of partial enzymes and applicable references. If the self-dissociation is unsuccessful, it is recommended to hand it over to our single-cell dissociation team for processing.

8. What should be done if there are more agglomerations of cells during the preparation of single cell suspension?

Answer: First of all, the possible cause of agglomeration should be clarified. There are generally the following reasons, which can be optimized according to the reasons 1: Tissue characteristics, for example, blood vessels or skin samples are prone to cell agglomeration; the total number of cells and the agglomeration rate can be determined. If the number is sufficient, the agglomeration rate is below 20%, and the follow-up can be performed after filtering by a cell sieve deal with. 2: Incomplete enzymolysis results in the connections between cells that have not yet been separated; the temperature and time of enzymatic hydrolysis can be re-optimized. 3: The natural agglomeration caused by the excessive centrifugation speed or the long standing time of the cell suspension; the cells can be re-washed with calcium-magnesium-free balanced salt solution, or the applicable EDTA can be added, but the concentration should not exceed 2mM. 4: Cell damage during the enzymolysis process causes DNA to be released into the suspension, which may attach to undigested tissues, affect the further digestion of the protease and cause agglomeration or attach to the cells and cause agglomeration. DnaseI can be added in a small amount, and the concentration should not exceed 0.1 mg/mL. Gently blow the cells so that free DNA can be digested without damaging the intact cells.

9. After preparing the cell suspension, do I need to sort the cells for subsequent separation and labeling?

Answer: After preparing the suspension, whether or not to sort the cells depends mainly on the purpose of the research. If it is to obtain a complete picture of the cell composition in the tissue, or to obtain the interaction relationship between different cells, it is not necessary to sort the cells; If you only focus on specific types of cells, such as immune cells, or the number of cells of interest is small, and multiple samples are required for enrichment, then one step of sorting is required; From the perspective of single-cell research trends and the rapid increase in the number of articles, sorting target cells for more detailed subject research may be a trend.

10. What are the cDNA and library quality inspection methods and standards for SeekOne® MM single-cell transcriptome?

Answer: cDNA quality inspection method: use Qubit to measure the concentration of cDNA sample, and Agilent to measure the fragment and peak type of cDNA sample. cDNA quality inspection standard: if the fragment range is 200-5000bp and the main peak is between 1000-2000bp, it is judged as qualified. Library quality inspection method: use Qubit to detect the concentration of library samples, and Agilent to detect the fragments and peak types of library samples. Library quality inspection standards: If the library peak type is 250-1500bp, the main peak is between 350-700bp, and there is no small linker contamination, it meets the sequencing requirements.

11. What are the applicable sequencing platforms for the sequencing library constructed by SeekOne® single-cell transcriptome?

Answer: This library is currently applicable to the Illumina high-throughput sequencing platform. If you use the MGISQ sequencing platform manufactured by MGI, you need to replace the sequencing adapter.

12. Does SeekGene provide pure sequencing and analysis services?

Answer: Yes, you can mail the library constructed by yourself according to the SeekOne® MM kit process (transported at -20°C).

13. What is the recommended single-cell transcriptome sequencing volume for SeekOne® MM series?

Answer: The sequencing strategy is PE150bp. It is recommended that the sequencing volume per cell is not less than 50K reads, and the total data volume is the number of cells × 50K reads. Based on the calculation of the capture of 6000 cells, it is recommended that each sample starts at 100g by default.

14. Is the sequencing library constructed by SeekOne® MM kit a base-balanced library?

Answer: In our library construction process design, a frameshift design is specially designed for UMI sequences, which can reduce the dependence on the balanced library to a certain extent. However, although there is a frameshift design, it is better to add a little balanced library. It is estimated that it will take about 15% at most.

15. Are the sequencing adapters provided by the SeekOne® MM kit complete?

Are the sequencing adapters provided by the SeekOne® MM kit complete? Answer: The final sequencing library provided by the kit does not lack primer sequences and linker sequences, and the linker primers synthesized by us are provided in the instructions. The actually built library is consistent with the official Illumina adapter sequence. The specific sequence is as follows: I5：5‘AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ I7： 5’TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG3’

16. Is SeekOne® Tools a special analysis software for SeekGene? Is it compatible with third-party software such as Seurat?

SeekOne® Tools is single cell data analysis software independently developed by SeekGene. It needs to be used in conjunction with the SeekOne MM® /DD single-cell transcription building library kit, and can be used after installation under the Linux system. It requires the client to have computing resources and a certain basis for credit. This software package can complete the basic quality control of off-machine data. The software has good performance and is compatible with data from a variety of single-cell technology platforms. In addition, the cell-gene expression matrix obtained by SeekOne® Tools analysis can also be directly imported into third-party software such as the Seurat software package for subsequent analysis.

17. What is the meaning of the Fraction reads in cells indicator in the single-cell data quality control, and at what value can it be considered as usable data?

Answer: This indicator is used to indicate the effective read ratio of the cell. The next step is to use this effective reads for subsequent analysis, which is often used to judge the effectiveness of samples and experiments. Generally, it is related to the poor state and viability of the sample tissue cells, more free extracellular RNA, or insufficient cell washing during the preparation of the suspension. Therefore, if the indicator is lower than 65%, the entire project situation needs to be reviewed. Generally speaking, if the results of cell clustering are in line with expectations, the problem of low indicators can be avoided to a certain extent by adding appropriate data.

18. What does the UMI ratio of mitochondrial genes mean in single-cell data quality control?

The UMI ratio of mitochondrial genes is generally considered to be related to apoptosis and damage. Generally, the permeability of the mitochondrial membrane is increased, which will induce the release of molecules such as apoptosis factor (AIF) into the cytoplasmic matrix and destroy the cell structure. Generally speaking, we will draw a violin chart based on the number of mitochondrial genes UMI of a cell to set a certain threshold and filter out cells above the threshold. This indicator is not fixed and is related to the actual situation of the sample. For example, in tissues with extremely high metabolic activity (such as the liver), the UMI ratio of mitochondrial genes will also be expressed at a higher level. Therefore, various quality control standards can be considered comprehensively. If other indicators are relatively normal, the high UMI ratio of mitochondrial genes may be due to sample characteristics. If other indicators are abnormal and the proportion of mitochondrial genes is too high, the tissue state and apoptosis damage may occur during the preparation of the experiment. According to the situation, additional data can be tested or single cell suspension samples can be re-prepared.

19. If the number of cells is still more than 10,000 after filtering according to conventional parameters, but other quality control parameters are good, what other parameters can be set or how to set to filter cells?

The current SeekOne® MM single-cell transcriptome kit captures a maximum of 10,000 cells per sample. A further increase in the number of cells will greatly increase the probability of multiple cells in the microwells, which will affect subsequent analysis. But it does not rule out the possibility of trying more cell capture. If these cells have been filtered using parameters such as the number of genes, the number of transcripts, and the ratio of mitochondrial genes, it indicates that these cells are qualified and no further filtering is required, and they can be used for subsequent analysis.

20. Which cells that the cell subtypes belong to after cell clustering?

We will annotate the cell types of the clustered cells. Generally speaking, there are three ways: 1. Use the automatic annotation software SingleR+Garnett to annotate the clustering results without manual intervention; 2. Perform cell annotation on the clustering results based on the single-cell marker database independently accumulated by SeekGene; 3. Carry out detailed annotation and artificial correction of the cell type through the SeekGene cell type annotation system and based on the marker provided by the customer or the marker of the published article.

21. When identifying rare cell subpopulations, how many cells are needed to be identified and clustered?

This is mainly determined by the difference between rare cell subpopulations and other populations. If the difference is sufficient, dozens of cells or even a few cells may be grouped separately. In addition, for the subpopulations of interest, you can choose the method of clustering again to find rare cell subpopulations.

22. How to perform cell communication analysis on single-cell transcriptome data?

The communication between cells mediated by ligands and receptors is essential for various biological processes such as development, differentiation and verification. As shown in the figure below, we mainly import the cell-gene expression data of the single-cell transcriptome into Cellphone DB, and match the known ligand-receptor relationship pairs in the database to obtain the cell communication relationship in the actual project.

23. In the analysis of pseudo-time sequence, what is the beginning of pseudo-time?

The differentiation and development of cells is a directional irreversible process. The pseudo-chronological analysis is to simulate the process of cell differentiation according to different cell states. Pseudo-time is a value that measures the state of a certain cell type we are interested in in the entire pseudo-chronological trajectory. The beginning of pseudo-time generally refers to the position of the node where the most primitive cell or early cell is located in the construction of the cell trajectory. At present, the Monocle R package is commonly used in pseudo-timing analysis. 23,730 genes and 301 sample libraries have been established in the complete package. The analysis step is: load the appropriate Marker gene from the difference analysis result of sequencing, and then perform dimensionality reduction and sorting to obtain the pseudo-chronological trajectory. The distance between the position of a specific cell subgroup on the trajectory and the root (possibly a group of progenitor cells) is the pseudo-time. Naturally, multiple cell subgroups can have multiple starting points and trajectories. In addition, pseudo-time sequence direction can be judged based on the cell rate analysis and the growth and development cycle status of cells. As shown in the figure below, the development of the glutamatergic cell lineage is inferred based on the pseudo-time sequence analysis. Early glutamatergic cells develop into two main cell lineages: granular neural progenitor cell lines (GNPs) and glutamatergic cerebellar nuclear cell line (glutamatergic CN).

24. Does the single-cell transcriptome have requirements for biological duplication?

Since the common samples of single-cell transcriptome technology come from clinical designs, there are no strict requirements for biological repetition of single-cell transcriptome. For clinical samples, it is generally possible to increase the number of individuals in each group according to the experimental design to improve the reliability of the data conclusions. For example, to study the microenvironment of breast cancer tumors, you can select more than 5 individuals with breast cancer to analyze cell type composition and other information from the whole. For animal model samples and other designs involving human factors, it is generally recommended to design more than 2 biological replicates. In addition, considering that the preparation of single cell suspension requires high tissue freshness and individual atypia, it is prone to batch effects caused by multiple batch experiments. Generally, the assessment of biological duplication is not so rigorous. As long as the distribution of cells on the tSNE map is mostly or close to overlap, and the proportions of cell subpopulations are close, it proves that the repeatability is acceptable. In addition, even if the reproducibility is relatively poor, it is recommended to first adopt the strategy of batch correction analysis to reduce the influence of batch effects on cell grouping analysis.

25. What should I do if the clinical sample has a batch effect?

The batch effect refers to the technical differences caused by the processing and measurement of samples in different batches that are not related to any biological variation recorded during the test. The first thing to declare is that the batch effect can theoretically exist in any experiment, and it cannot be completely removed but can only be reduced. There are more influencing factors limited by clinical sample collection, and we can reduce the impact as much as possible from multiple angles. For example: in the experimental link, it is best to collect samples and build a library of dissociation markers at one time. If you can’t achieve this, you can sample and mark the database in batches, and it’s best to design samples in pairs. (Such as the first batch: the cancer and adjacent cancers of the same patient; the second batch: the cancer and adjacent cancers of the second person). In the analysis link, batch correction processing can be carried out at the software level (Harmony, seurat comes with correction methods are optional). This can reduce the batch effect between samples and retain the true clustering results of the cells to the greatest extent.